Canon PowerShot S100
ƒ/2.2
6.012 mm
1/30
160

Dan Gibson took us on a tour of the La Jolla labs as SGI-DNA went live today. They have built a robotic DNA synthesis array with Gibson’s magic methods to assemble genes from bench-top beakers of chemicals.

Next step: Craig Venter’s dream of the Digital Biological Converter — print to life. This is now known as the BioXp

4 responses to “SGI-DNA Launch”

  1. Here is an earlier subsystem; beakers of A,G,T,C and a conveyor of reaction vessels…IMG_1907SGI-DNA is in the same building as the AgBio derivatives Agracast and Agradis (recently acquired by Monsanto)…IMG_1923In the hallway of the new digs… the DNA medium encodes the message: “bridging the gap between the digital and biological worlds.”
    IMG_1909

    They offer a DNA translator
    My name is GCTTGATAATTGTAAATAGTTTCCCTATTGTAATGAGCTCGTTGC

  2. This goes through insane and right out of the other side. And makes microelectronics look dull, which is a remarkable achievement.

  3. And now, the The Digital-to-Biological Converter (DBC), or "life printer", just came out in Nature Biotech.

    Opening, by Dan Gibson and the Synthetic Genomics team: "DNA templates, RNA molecules, proteins and viral particles were produced in an automated fashion from digitally transmitted DNA sequences without human intervention."

    Highlights: "First, we synthesized a 1.5-kb DNA fragment encoding GFP."
    "We next synthesized Orencia (abatacept), Lucentis (ranibizumab) and Herceptin (trastuzumab) antibody polypeptides"
    "We next applied the DBC to produce an RNA vaccine and a bacteriophage, both of which have potential as therapeutics for infectious diseases."
    "We also produced functional influenza viral particles (H1N1)"
    "Finally, we fully automated production of the ΦX174 bacteriophage, which has a 5,386-bp genome, on the DBC. The genome sequence was manually designed in silico"
    "with the incorporation of large-scale synthesis technologies, one can envision the DBC being used in industrial settings to enable high- volume production of biologics such as proteins and RNA vaccines."

    Summary release from SGI.

Leave a Reply to Ramones Karaoke Cancel reply

Your email address will not be published. Required fields are marked *